18 Ene

Homenaje Póstumo al Profesor Quiterio Núñez Miranda: Maestro Sanmarquino

Promoción de Médicos Veterinarios 1968
Marcelo Rojas Cairampoma
(Editor)

Obituario

En 1964 ingresó a la Universidad Nacional Mayor de San Marcos (Decana Mega universidad de América) una generación de jóvenes para estudiar Medicina Veterinaria (http://mrojas.perulactea.com/2014/03/04/promocion-de-ingresantes-a-la-veterinaria-sanmarquina-cincuenta-aniversario/#more-1608), de los cuales, cinco años después se graduaron 22 Médicos Veterinarios: Juan Carlos Arce Del Campo, Luis Ayala Huamán, Orlando Bazán Alfaro, José Beyá Beteta, Guillermo Calderón Barrantes, Iván Caletti Paganin, Marcos Carrión Ruelas, Moisés Gutiérrez Robles, Moisés Inzua Rodríguez (QEPD), Miguel Iparraguirre Gayoso (QEPD), Carlos Lembke Palacios (QEPD), Ricardo León Rodríguez, Alfredo Núñez Ladera, Carlos Pinedo Díaz, Edmundo Pimentel Sevilla, Jorge Quintana Lora, César Ramírez Barreto, Marcelo Rojas Cairampoma, Consuelo Sáenz de Valega, Víctor Torrejón Del Águila (QEPD), Humberto Valenzuela Oré (QEPD) e Ivanoe Vega Gatti.

En el transito académico aprendimos a distinguir las múltiples cualidades personales y académicas de nuestros maestros; y fue entonces que la figura del Profesor Quiterio Nuñez Miranda, emergió como el maestro, pero además: el amigo, orientador y consejero, para inquietudes como la ciencia, y cuya cultura se aprecia ahora en la historia discente de San Marcos (http://mrojas.perulactea.com/2011/01/27/medicina-veterinaria-lider-en-produccion-y-culturizacion-cientifica-en-la-universidad-nacional-mayor-de-san-marcos/#more-566).

Fue así que, con plena convicción la Promoción eligió a nuestro ilustre tutor, como Padrino de la Promoción, que luego ha quedado perennizada en la Fig 1.

Se suele decir que los homenajes oportunos son los que se recibe en vida. Sin embargo la Promoción siempre tuvo la suerte y la satisfacción de reiterarle nuestra gratitud y simpatía; especialmente con ocasión de las Bodas de Plata, y su Clase del recuerdo; pero también en varias reuniones amicales con él y su familia. Ejemplo: http://mrojas.perulactea.com/2011/09/29/medicos-veterinarios-sanmarquinos-promocion-1968reencuentro-y-remembranzas-en-setiembre-2011/#more-762.

El maestro Quiterio Núñez, disfrutó de la invalorable satisfacción de impartir sus conocimientos en dos universidades de Sudamérica: Universidad Nacional Mayor de San Marcos y Universidad Experimental Francisco de Miranda (Fig 2).

Apreciado maestro: ¡Descanse en Paz!. (15/01/2016). Continue reading

18 Ene

Parte 3. Libro Paramphistomosis en Bovinos y Ovinos en Cajamarca

BIOLOGÍA MOLECULAR

La Figura 1 muestra los resultados de la amplificación del ITS-2+ de las treinta muestras de Paramphistómidos amplificaron fragmentos idénticos cuyas longitud de bandas fueron aproximadamente de ~ 500 bp al igual que el control positivo Paramphistomun leydeni que a pesar de su hospedador definitivo son  ovinos,  es  usado  debido  a  que  pertenece  a  la  familia.Figura 1.
Gel de agarosa teñido con SYBRsafe (Invitrogen) mostrando los productos de PCR conteniendo los ITS-2+ de 30 muestras de Paramphistómidos colectados de vacunos.

Panel A:       Calle L Marcador de peso molecular (100pb)

Calle +:

Calle – : Control negativo (sin muestra)

Calle 1 – 15: Muestras 1 – 15

Panel B:       Calle L: Marcado de peso molecular (100 pb.)

Calle +: Muestra de Paramphistomum leydeni

Calle -: Control negativo (sin muestra)

Calle 16 – 30: Muestras 16 – 30.

Los análisis de RFLP de los productos del PCR,  utilizando  las endonucleasas  HinfI  y  Tru1I  no  mostraron diferencias significativas de los patrones de restricción en las treinta muestras analizadas. Pero si se observó marcada diferencia entre las treinta muestras y el control positivo (Paramphistomun leydeni), el cual es usado  para  contrastar  el  género  de  los  parásitos. El peso molecular aproximado de los fragmentos producidos por cada endonucleasa se muestra en la Tabla 1.

Paramphistómidos - RFLP de los productos del PCRTabla 1. Resultados de RFLP de las enzimas de restricción mostrando aproximadamente la longitud expresada en pares de bases (bp) y número de fragmentos. El tamaño de los fragmentos fue determinado con el software GelAnalyzer2010®.

La figura 2 muestra los patrones de bandas de PCR-RFLP para la endonucleasa de restricción Tru1I en donde el control positivo (Paramphistomun leydeni) muestra un patrón de tres fragmentos de aproximadamente 60 bp, 150 bp y 190 bp; en contraste con el ADN amplificado de  los treinta parásitos analizados,  los cuales muestran un solo patrón de banda de aproximadamente 470 bp Figura 2. Gel de agarosa al 2 % teñido con SYBRsafe mostrando los patrones de RFLP de los ITS-2+ amplificados con la endonucleasa Tru1I, de 30 muestras de Paramphistómidos colectados de vacunos.

Fig. 02 Paramphistómidos PCR-RFLP

Panel A: Calle L: Marcador de peso molecular (100pb.)

Calle+: Muestra de Paramphistomun leydeni Calle –: Control negativo (sin muestra

Calle 1 – 15: Muestras 1 – 15

Panel B: Calle L: Marcado de peso molecular (100pb.)

Calle +: Muestra de Paramphistomum leydeni Calle -: Control negativo (sin muestra)

Calle 16 – 30: Muestras 16 – 30

La Figura 3 muestra los patrones de bandas de PCR-RFLP para la endonucleasa de restricción HinfI, en donde el control positivo (Paramphistomun leydeni) muestra un patrón de tres fragmentos de aproximadamente 130 bp, 170 bp y 200 bp; en contraste con la del ADN amplificado de los treinta parásitos analizados, los cuales muestran dos fragmentos de aproximadamente 217 bp y 250 bp.
Fig. 03 Paramphistómidos PCR-RFLP

Figura 3. Gel de agarosa al 2% mostrando patrones de RFLP de los ITS-2+ amplificados de 30 muestras de Paramphistómidos colectados de vacunos con la   endonucleasa HinfI.

Panel A: Calle L: Marcador de peso molecular (100 pb.)

Calle+ : Muestra de Paramphistomun leydeni

Calle – : Control negativo (sin muestra)

Calle 1 – 15: Muestras 1 – 15

Panel B: Calle: Marcado de peso molecular (100 pb.)

Calle +: Muestra de Paramphistomum leydeni

Calle – : Control negativo (sin muestra)

Calle 16 – 30: Muestras 16 – 30

El fragmento ITS-2+ de los especímenes secuenciados muestran una secuencia consenso de 427 bp, la cual está compuesta de la secuencia entera ITS-2 (283 bp),   más las secuencias de los extremos, 5.8S (119 bp) y 28S (25 bp). Se compara la secuencia consenso  final  obtenida  con  otras  secuencias  disponibles  en internet utilizando el programa BLAST (NCBI), e inscritas en el GenBank ®.

GCCAACTGTGGTGGAAGTTTAAGTGTGAACTGCATACGTGCTGTTTGAACATCGACAGTCGTTGAACGCACATTGCGGCCACGGGTTTTCCTGTGGCCACGCCTGTCCGAGGGTCGGCTTATAAACTATCACGACGCCCAAAAAGTCGTGGCTTGGAATCTGCCAGCTGGCGTGATTTCCTCTGTGGTTCGCCACGTGAGGTGCCAGATCTATGGCGTTTTCCTAATGTCTCCGGACACAACCGCGTCTTGCTGGTAGCGCAGACGAGGGTGTGGCGGTAGAGTCGTGGCTCAATGAACTGTAATGGTAGCACGCTCTGCCGTTGTGCCTTTGTTAGTGTAACTGGTTTGAGATGCTATTGCTGTCCGCCCAATCATGATCACCTGCTATGGTGTTCTGTTACCTGACCTCGGATCAGACGTGAATA

Figura 4. Secuencia consenso de Calicophoron. microbothrioides con longitud de 427 bp. Secuencia completa del ITS2 de 283 bp (subrayado). Secuencia parcial subunidad ribosómica 5.8 S de 119 bp (antes de subrayar). Secuencia parcial subunidad ribosómica 28 S de 25 bp (después del subrayado).

La Figura 5 muestra un dendograma, el cual es elaborado por el programa BLAST (NCBI), para reconocer la distancia en el árbol filogenético con referencia a otras especies. Por lo tanto, teniendo en cuenta todas las muestras secuenciadas en ambos sentidos (adelante y atrás), se obtuvo una secuencia consenso con 99% de identidad con Calicophoron microbothrioides.

Figura 5.  Árbol de la distancia de la secuencia consenso de amphistomas de Cajamarca (kcl|12225) alineado por BLASTN ®, mostrando una homología de 99 % con Calicophoron micobothrioideS. (Fuente Manrrique. A 2013).

LOCALIZACIÓN

El parásito adulto  se localiza en el rumen especialmente  en  la superficie dorsal del pilar anterior y en la porción dorsal y ventral del pilar posterior, retículo y omaso.

Las  formas  juveniles  se  pueden  encontrar  en  el  abomaso  e intestino delgado, raramente en las vías biliares.

UBICACIÓN

Paramphistómidos en el RumenParamphistómidos en el Retículo

Paramphistómidos en el OMASOParamphistómidos en el ABOMASO

Paramphistómidos en el INTESTINO DELGADOParamphistómidos - LARVA

HOSPEDEROS

Hospedadores definitivos

Se  considera  como  hospedadores  definitivos  a  los  herbívoros entre los que encontramos: A los Bovinos,  siendo estos los  hospedadores  más  comunes,  seguidos  de ovinos y caprinos también  se podrían  tener  en  cuenta  a  los  camélidos   aunque en menor escala.

VACUNO

ovino - caprino

Hospedadores Intermediarios

Los Hospedadores Intermediarios son los moluscos pulmonados de agua dulce. Estos moluscos pertenecen principalmente a las familias: Planorbidae (Planorbis, Segmentina, etc.), Bulinidae (Bulinus) y Lymnaeidae (Lymnaea).

moluscos pulmonados de agua dulce

CICLO BIOLÓGICO

Cuando los huevos son eliminados, mezclados con las excretas del hospedero definitivo, se encuentran, en los primeros estadios de la segmentación. El tiempo de desarrollo varía según la temperatura, in vitro es de aproximadamente 44 días. Cuando los miracidios abandonan el huevo, nadan en el agua y penetran en un  caracol  acuático  a  través  del  neumostoma  posterior  de  la cavidad del manto; también, pueden penetrar por las partes expuestas del caracol. Al respecto, los caracoles jóvenes son más receptivos que los mayores,  porque la cavidad del  manto  está completamente llena de agua y la abertura pulmonar está siempre abierta. Los hospedadores intermediarios son los Caracoles de los géneros: Bulinus, Glyotanusis, Indoplanorbis, Limnaea, Norbis, Pseudosuccinea, Fossaria, Phygmanisus y Glyptanisus.

Posteriormente,  los  miracidios  pierden  los  cilios superficiales y al cabo de unas 12 horas, se forma un esporocisto alargado de 93 por 53 mm.

El desarrollo en el caracol en condiciones favorables (26 – 30 °C) puede completarse en cuatro semanas. Existe un gran desarrollo de  los  esporocistos  al  cabo  de  11  días,  encontrándose  ya maduros y conteniendo cada uno de ellos un máximo de ocho redias, éstas se liberan y experimentan un notable crecimiento y, al cabo de unos 21 días post infestación, miden entre 0.5 y 1 mm. de longitud, y contienen entre 15 y 30 cercarías. En ciertas condiciones se forman redias hijas. Cuando las cercarias son eliminadas  de  las  redias,  aún  son  inmaduras  y  necesitan  un tiempo de maduración en los tejidos del molusco  antes de  ser eliminadas. Este periodo a 27°C es de 13 días.

Las cercarias son eliminadas del caracol cuando son estimuladas  por la luz. Las cercarías liberadas son fácilmente reconocibles como “anfistoma” por la presencia de la ventosa oral y la posterior. Son activas por algunas horas, y luego se enquistan en la vegetación u materia orgánica que se encuentran en el agua. Al cabo de unos 10 minutos, el enquistamiento se ha completado, y las nuevas metacercarías se oscurecen hasta ser casi negras. La viabilidad de esta fase se mantiene durante un periodo de alrededor de tres meses. Después de la ingestión de las metacercarias enquistadas en los vegetales, todo el desarrollo en el hospedero definitivo tiene lugar en el tracto digestivo. Después de desenquistarse en el duodeno y abomaso las fases juveniles se fijan y alimentan en dicha localización durante aproximadamente seis semanas antes de desplazarse hacia el rumen, retículo y omaso donde alcanzan la madurez. El  periodo de prepatencia oscila entre 7 y 10 semanas. Los huevos aparecen en las heces a los 56 días en los bovinos, en 69 días en caprinos y a los 71 días en ovinos.

Ciclo Biológico

DIFERENTES ESTADIOS EVOLUTIVOS

Huevos: Los huevos miden de 140 a 150 µm  de largo por 65 a 85µm de ancho, tienen forma ovalada (el polo operculado  es  más  fino  que  el  opuesto).  A  diferencia  de  los huevos  de  Fasciola  hepatica,  los del Calicophoron microbothridioides  son  más claros y tienen el cigoto localizado en la parte medial posterior (en la Fasciola hepatica se localiza en la posición medial anterior). La cubierta es delgada e incolora y las células embrionarias se encuentran  completamente  delimitadas.  En el  polo  posterior  se observa una protuberancia.Huevos Calicophoron

Miracidio: Es la forma infectiva para el hospedero intermediario. El miracidio es ancho en su parte anterior con una papila móvil y una glándula apical, que permiten la penetración en el caracol (hospedero intermediario). Su tegumento se  halla  recubierto  de cilios que permiten su desplazamiento en el agua.Miracidio - Calicophoron microbothridioides

Esporocisto: Es la  primera  forma  larvaria  que  se  desarrolla dentro del molusco, es de forma sacciforme de 93 por 53 µm. Al cabo de 11 días los esporocistos ya están maduros y contienen cada uno de ellos un máximo de 8 redias.Esporocisto-Calicophoron-microbothridioides

Redia: Miden de 1.2 por 0.15 mm de tamaño, los cuales después de 20 días, se liberan y producen redias hijas, y a los 39 días, a nivel de las glándulas del intestino medio producen redias nietas.

Calicophoron microbothridioides - REDIA CON CERCARÍAS

Cercaría: Las cercarías maduras de color marrón oscuro y poseen 2 manchas oculares. Miden de 350 a 280µm (cercarías pigmentadas), poseen una cola propulsora más larga que el cuerpo y una faringe de 50µm. Las  cercarías  abandonan los caracoles en momentos de gran claridad, en condiciones óptimas en horas de mayor intensidad solar nadan cerca de la superficie del agua de un lado para otro y se fijan a las plantas.

Calicophoron microbothridioides - CERCARIA

Metacercaria: Forma quística infectiva, que son ingeridas por los animales  que  pastan,  mide  250µm  y  están  rodeados  de  unas membranas resistentes, una externa de estructura fibrosa y otra interna.

Calicophoron microbothridioides - METACERCARIA

Calicophoron microbothrioides adulto al estado fresco:

El color de los ejemplares adultos vivos es rojo claro o rosado, cuerpo piriforme, ligeramente cóncavo ventralmente y convexo dorsalmente,  el  cuerpo  está  recubierto  por  un  tegumento  con papilas distribuidas por todas las regiones. Los vermes miden alrededor  de  5 a  13 por  2 a 5  mm de  diámetro.  Poseen  una ventosa ventral terminal más grande y potente que la oral.

La ventosa oral se encuentra en el polo anterior más delgado. La abertura genital o  poro genital se encuentra al final del primer tercio del cuerpo. Los testículos son ligeramente lobulados, localizados en la mitad posterior del cuerpo y anteriores al ovario.

El parásito en estado fresco es de color rosado pálido a rosado claro, de forma cónica no aplanada, con un promedio de  9±0.76mm de largo y con un promedio de 2mm de diámetro en el extremo   anterior,   con   4 ± 0.76  mm   de   ancho   y   2   mm de diámetro aproximadamente en el extremo anterior, con 4 ± 0.88 mm de diámetro en el extremo posterior. Y 1 mm de diámetro en la ventosa oral ubicada en el extremo anterior y 1.5 ±0.5 mm de diámetro en la ventosa ventral ubicada en extremo posterior.

Calicophoron microbothrioides

PATOGENIA

La enfermedad   clínica   aparece   sólo   cuando hay   enormes cantidades de parásitos inmaduros en duodeno y abomaso, y las que emigran producen enteritis aguda. Los trastornos clínicos producidos por  los  tremátodos adultos fijados a  la  mucosa  del rumen retículo y omaso, son menores que los originados por las fases juveniles emigrantes, las cuales provocan gastroenteritis aguda o crónica. En el ganado joven muchas veces tiene curso mortal, aunque en el mayor número de los casos el cuadro clínico se caracteriza por diarreas sanguinolentas. En infecciones intensas, los tremátodos adultos provocan una lesión de la capa superficial y de los tejidos subyacentes del rumen. Las formas adultas en el rumen llegan a destruir gran parte de la mucosa ruminal en donde se encuentran implantados.   Los   tremátodos   inmaduros   se   incrustan   en   la mucosa del duodeno-yeyuno y nódulos linfáticos del mesenterio. Aparece infiltración edematosa en la pared intestinal, existiendo también enteritis hemorrágica y destrucción de las células glandulares   y   nerviosas.   Hay   necrosis   tisular   debido   a   la destrucción celular y a la reabsorción de sustancias tóxicas. La acción mecánica llega a la submucosa destruyendo las glándulas digestivas del intestino delgado y del abomaso ocasionando un síndrome  de  mala  digestión  y  mala  absorción.  Los  parásitos jóvenes en contacto con la submucosa ejercen una acción antigénica con impregnación de tejido linfoide y la formación de anticuerpos. La gravedad que ocasiona la acción expoliatriz está en relación directa a la cantidad de parásitos pues su alimentación está basada en líquidos y células del lugar donde se albergan. Además producen daño traumático, tanto los tremátodos adultos e inmaduros, por la fijación de su ventosa ventral succionando parte de la mucosa y perturbando la irrigación sanguínea, con pérdida de sangre, lo que puede explicar la anemia de esta parasitosis. Los animales infectados pueden desmejorar rápidamente. Suele aparecer edema debajo del maxilar inferior (quijada de botella) y presentarse diarrea negruzca de olor fétido. Debido a que la enfermedad   aguda   es   provocada   por   la   forma   inmadura, usualmente  no  se  encuentran  huevos  en  las  heces.  En  la necropsia, las fases juveniles aparecen apiñadas, de color rosa pardo y unidas a la mucosa duodenal, ocasionalmente también se encuentran en el yeyuno, abomaso,  y en  el  rumen  las formas maduras se encuentran bien adheridas a la mucosa.

PATOGENIA DEL CALICOPHORON MICROBOTHRIDIOIDES

Patogenia del Calicophoron microbothridioides - Rumen y retículo

Patogenia del Calicophoron microbothridioides - Omaso

Patogenia del Calicophoron microbothridioides - Abomaso

Patogenia del Calicophoron microbothridioides - Gastritis

Patogenia del Calicophoron microbothridioides - Intestino D

28 Dic

El intangible Poder: Una percepción holística de su dinámica y fuentes

Marcelo Rojas Cairampoma

Profesor Principal cesante de Parasitología veterinaria de la Universidad Nacional Mayor de San Marcos (Decana de América). Miembro Honorario de la Asociación Peruana de Parasitólogos. Ex Miembro Titular de la Academia Peruana de Ciencias Veterinarias. Profesor de las Escuelas de Post Grado en la Universidad Nacional San Luís Gonzaga de Ica, Universidad Peruana Los Andes, Universidad Nacional de Cajamarca y Universidad Autónoma de Nuevo León (México).

Resumen

El Poder, como herramienta de la autoridad o soberanía, siempre ha estado y estará vigente en la sociedad; cambiando de manos y protagonismo a través del tiempo y el espacio. Es una innata aspiración del ser humano, noble o patológica, acceder al poder. Lo siguiente es un ejercicio para ver al intangible poder desde una perspectiva holística, y también desde sus actores temporales, en tanto mayores o menores protagonismos. Por otro lado, es un ejemplo para aprender a manejar variables en la investigación científica.

Palabras clave: Poder ǀ Variables tangibles ǀ Variables intangibles ǀ Protagonistas ǀ Vigencia en el tiempo. Continue reading

23 Dic

Parte 2. Libro Paramphistomosis en Bovinos y Ovinos en Cajamarca

MORFOLOGÍA

Se trata de parásitos de cuerpo poco aplanado, moderadamente pequeños, cónicos, ovales, piriformes o elípticos. Por medio de la ventosa oral, se adhieren a la mucosa del rumen, retículo y abomaso de vacunos, ovinos, caprinos y muchos otros rumiantes, exponiendo las ventosas posteriores para realizar funciones de fijación.

MORFOLOGÍA  DEL  PARÁSITO  ADULTO  EN  ESTADO FRESCO.

Según estudios realizados en Laboratorio de Parasitología de la Facultad de Ciencias Veterinarias de La Universidad Nacional de Cajamarca se ha determinado que el parásito presenta las siguientes características:

Forma: Conoide con  cara  ventral  algo  cóncava  y  la  dorsal  es convexa, cuerpo arqueado, además la parte anterior es más estrecha que la posterior.

Tamaño: de 5 a 15 mm. de largo por 2 a 5 mm. de ancho

Color: Rojo cárnico (rosado) o rojo brillante.

Presenta ventosa oral (organela de la alimentación) y una ventosa en la parte posterior (órganela de fijacion) la que está rodeada por una  protuberancia,  hasta  ella  llegan  dos  ramas  intestinales. Esófago  corto,  dos  testículos  débilmente  lobulados,  tras  ellos están los ovarios, las glándulas vitelógenas laterales y muy desarrolladas.

El  acetábulo  está  situado  cerca del extremo  posterior  y puede estar muy desarrollado; la cutícula no tiene espinas, el poro genital se abre en la cara ventral sobre la línea media del tercio anterior. El  útero  es  visible  desde  la  cara  dorsal  del  parásito  y  esta enrollado Continue reading

23 Dic

Parte 1. Libro Paramphistomosis en Bovinos y Ovinos en Cajamarca

PARAMPHISTOMIDOSIS EN BOVINOS

 INTRODUCCIÓN

Cajamarca es una de las principales cuencas lecheras del país, hace  décadas  que  está  amenazada  por  enfermedades parasitarias ocasionadas por nematodos y trematodos, sobresaliendo la fasciolosis por su alta prevalencia. Últimamente se viene investigando sobre otro trematodo, un Paramphistomido, cuya  localización  es  el  rumen, retículo, omaso  y  sus  formas  juveniles  en  el abomaso y duodeno.

La Paramphistomidosis es una enfermedad parasitaria emergente que afecta a rumiantes salvajes y domésticos como los bovinos, causada por parásitos de la familia Paramphistomidae dentro de los que se incluye al Gastrodiscus aegypti, Gastrodiscus secundus que se localiza en el Intestino delgado de porcinos y equinos,al Pseudodiscus en el Colon de equinos y al Gastrodiscoides hominis que ataca a humanos, porcinos ocasionando graves problemas de Salud Publica, parásitos que  están presentes casi en todo el  mundo, encontrándose con mayor frecuencia en regiones tropicales y subtropicales habiéndose adaptado muy bien en la cuenca lechera de Cajamarca. Estos parásitos ocasionan pérdidas económicas por disminución de peso, baja de producción y productividad.  En casos severos pueden ocasionar la muerte de los animales. Los principales síntomas de la Paramphistomidosis son retraso en el crecimiento, síndrome de mala digestión y mala absorción, desnutrición,  problemas  reproductivos, enflaquecimiento progresivo (caquexia) lo que causa que el animal se torne inmunodeprimido y pueda ser atacado por otros agentes patógenos, ocasionando problemas de morbimortalidad.

Los últimos estudios demuestran que existe asociación entre Fasciola hepatica y Paramphistomidos alcanzando una prevalencia de aproximadamente el 30%. Ambos parásitos tiene un ciclo evolutivo  indirecto, además comparten el mismo  hospedero intermediario como es el caracol Lymnaea viatrix, también utilizan al Bullinus,  que   pueden   encontrarse   en   medios   acuáticos.

En el presente libro, se hace de conocimiento sobre esta enfermedad  con  el  propósito  de  contribuir  a mejorar  o  aplicar medidas de prevención y control de la paramphistomidosis y evitar se den falsos positivos cuando se realicen investigaciones sobre fasciolasis. Continue reading

10 Dic

Tesis de Grado: Perfil académico del Asesor

Marcelo Rojas Cairampoma

 Profesor Principal cesante de Parasitología veterinaria de la Universidad Nacional Mayor de San Marcos (Decana de América). Miembro Honorario de la Asociación Peruana de Parasitólogos. Ex Miembro Titular de la Academia Peruana de Ciencias Veterinarias. Profesor de las Escuelas de Post Grado en la Universidad Nacional San Luís Gonzaga de Ica, Universidad Peruana Los Andes, Universidad Nacional de Cajamarca y Universidad Autónoma de Nuevo León (México).

Resumen

 En el empeño de colaborar en la mejora de la ciencia y tecnología peruana, se precisa las características de deberían tener los asesores de las Tesis de Grado: Redacción científica, Manejo de conocimientos, Tesis de Grado, Artículos científicos y Pensamiento complejo. El desencadenante final para desarrollar el tema fue el reciente testimonio: Estimado doctor…. con lo del cumplimiento de la Ley universitaria somos varias aulas de estudiantes que planeamos sacar la Tesis de Posgrado, puedo decirle que luego de varios intentos en 2 años, estoy entendiendo cómo es hacer una investigación científica y, cuando encontré su libro en la red, tan didáctico, me pregunte por qué no nos pueden enseñar así en las aulas?

Palabras clave: Tesis de Grado ǀ Asesor ǀ Redacción científica ǀ Esquema lógico ǀ Pensamiento complejo ǀ Ley universitaria 30220 ǀ Perú.

Introducción

Ante la inminente vigencia de la nueva Ley universitaria 30220, que entre sus bondades restituye la sustentación de la Tesis de Grado, o similares; desafío que demanda la disponibilidad  de  profesores  competentes  en  la  asesoría  o  consultoría,  tanto  del Proyecto de Tesis, cuanto de  la presentación   final de la Tesis (http://mrojas.perulactea.com/2014/07/17/tesis-de-grado-y-redaccion-cientifica-en-peru-  situacion-y-desafio-ante-la-ley-universitaria-n-30220/#more-1745). Continue reading

1 Dic

Huamalí: 114avo Aniversario

Marcelo Rojas Cairampoma

Profesor Principal cesante de Parasitología veterinaria de la Universidad Nacional Mayor de San Marcos (Decana de América). Miembro Honorario de la Asociación Peruana de Parasitólogos. Ex Miembro Titular de la Academia Peruana de Ciencias Veterinarias. Profesor de las Escuelas de Post Grado en la Universidad Nacional San Luís Gonzaga de Ica, Universidad Peruana Los Andes, Universidad Nacional de Cajamarca y Universidad Autónoma de Nuevo León (México).

Resumen

 Con el ánimo de aportar conocimientos relativos al distrito de Huamali, se presenta información gráfica sobre el Índice de Desarrollo Humano, y población humana comparativa, del distrito en su entorno Provincial y Regional. Del análisis de las data, se plantea la siguiente pregunta: ¿Qué están haciendo, o no haciendo, las autoridades para evitar el decrecimiento poblacional de sus jurisdicciones?, y para Huamalí: ¿Qué están haciendo, o no haciendo, los Alcaldes para evitar el decrecimiento poblacional huamalino?. Continue reading

30 Nov

Visión retrospectiva político económico del Perú y referentes para las Elecciones del 2016

Marcelo Rojas Cairampoma

Profesor Principal cesante de Parasitología veterinaria de la Universidad Nacional Mayor de San Marcos (Decana de América). Miembro Honorario de la Asociación Peruana de Parasitólogos. Ex Miembro Titular de la Academia Peruana de Ciencias Veterinarias. Profesor de las Escuelas de Post Grado en la Universidad Nacional San Luís Gonzaga de Ica, Universidad Peruana Los Andes, Universidad Nacional de Cajamarca y Universidad Autónoma de Nuevo León (México).

Resumen

Se muestra una visión retrospectiva gráfica de historia económica, política y de la corrupción del Perú, en aras de aportar información histórica para analizar y contrastar con las ofertas electorales de los candidatos políticos, en las próximas elecciones en abril del 2016. Con la gran pregunta del elector: ¿Qué problema quiere solucionar, y cómo lo va hacer?, y también el arma de los políticos: el poder de la palabra.

Palabras clave: Historia económica ǀ Historia política ǀ opción política ciudadana ǀ historia de la corrupción ǀ Ofertas electorales ǀ Poder de la palabra ǀ Perú 2016. Continue reading

18 Nov

Acreditación universitaria y validez de las Tesis de Grado

Marcelo Rojas Cairampoma

Profesor Principal cesante de Parasitología veterinaria de la Universidad Nacional Mayor de San Marcos (Decana de América). Miembro Honorario de la Asociación Peruana de Parasitólogos. Ex Miembro Titular de la Academia Peruana de Ciencias Veterinarias. Profesor de las Escuelas de Post Grado en la Universidad Nacional San Luís Gonzaga de Ica, Universidad Peruana Los Andes, Universidad Nacional de Cajamarca y Universidad Autónoma de Nuevo León (México).

Resumen

Se presenta una reflexión sobre la responsabilidad de las Acreditadores de la Calidad universitaria peruana, en lo concerniente a la validez y confiabilidad de la originalidad de las Tesis de Grado; surgida a propósito de un plagio total, en el ámbito universitario. Entonces, en el qué hacer de los Acreditadores de la Calidad universitaria peruana: ¿sus Indicadores, son suficientemente sensibles y competentes para medir la validez y confiabilidad de la redacción científica de las Tesis de Grado?. Palabras clave: Tesis de Grado ǀ Plagio ǀ Hurto intelectual ǀ Indicador de Calidad ǀ Organismos de Acreditación universitaria ǀ Redacción científica ǀ Rankings universitarios. Continue reading